View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12032_low_19 (Length: 231)
Name: NF12032_low_19
Description: NF12032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12032_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 3100034 - 3100249
Alignment:
| Q |
1 |
acataggtttcaacaacannnnnnnactcttgtagtattacgtaaactaagctcattcccaaatccaaattatataatcaaacacgctctatgacttgtc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3100034 |
acataggtttcaacaacatttttttactcttgtagtattaggtaaactaagctcattcccaaatccaaattatataatcaaacacgctctatgacttgtc |
3100133 |
T |
|
| Q |
101 |
aagtagtccttgtcgggtactttagtagtttagtaaataagacgaacatgtcaactttgagcaagctggaaagaaaaacgatgaatgtaaccaacattta |
200 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3100134 |
aagtagtacttgtcgggtaccttagtagtttagtaaatacgacgaacatgtcaactttgtgcaagctggaaagaaaaacgatgaatgtaaccaacattta |
3100233 |
T |
|
| Q |
201 |
aatacgaagatggcca |
216 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
3100234 |
aatacgaagatagcca |
3100249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University