View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12033_high_13 (Length: 391)
Name: NF12033_high_13
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12033_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 18 - 377
Target Start/End: Complemental strand, 49886204 - 49885849
Alignment:
| Q |
18 |
ttattaaatgtaacaccggggcatgtatgcatcttgctgcatctcatatccactaccattggtgtagctgaagttccccttatatttgaaaaatgaatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49886204 |
ttattaaatgtaacaccggggcatgtatgcatcttgctgcatctcatatccactaccattggtgtagctgaagttccccttatatttgaaaaatgaatat |
49886105 |
T |
 |
| Q |
118 |
ttgcaatcttcaccaatgaaggctgcatgcacgaaaataaatatataagtatcacaattattaacatcttgctgttaaaatagtttttgttgtagtgcaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49886104 |
ttgcaatcttcaccaatgaaggctgca----cgtaaataaatatataagtatcacaattattaacatcttgctgttaaaatagtttttgttgtagtgcaa |
49886009 |
T |
 |
| Q |
218 |
ataagtaccttctttttacaaatatcatcacattcatactcctggtcaataatgattggatttttaacatttgtcatgttaatgttagtgaaaaatatct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49886008 |
ataagtaccttctttttacaaatatcatcacattcatattcctggtcaataatgattggatttttaacatttgtcatgttaatgttagtgaaaaatatct |
49885909 |
T |
 |
| Q |
318 |
cagatgctccaccagcaaatctctctggaaatgattttattctcaaaccgttgtctgtgc |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49885908 |
cagatgctccaccagcaaatctctctggaaatgattttattctcaaaccgttgtctgtgc |
49885849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University