View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12033_high_23 (Length: 265)
Name: NF12033_high_23
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12033_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 43989329 - 43989570
Alignment:
| Q |
1 |
agaaggagtggacggcgcagacatagtgaccatggacagtggcgaaagagaacgaattgaacagagaagaagaataaggaaaaggtgtgggacgacatga |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43989329 |
agaaggagtggacggcgcagacacagtgaccatggacagtggcgaaagagaacgaattgaacagagaagaagaataaggaaaaggtgtgggacgacatga |
43989428 |
T |
|
| Q |
101 |
tcgtaagtcaaagaaggagaacaaggcaaccgaggacaatatgacaatgggctctaaaacatgaggaattcnnnnnnngctgagacacgggttacttaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43989429 |
tcgtaagtcaaagaaggagaacaaggcaaccgaggacaatatgacaatgggctctaaaacatgaggaattctttttttgctgagacacgggttacttaca |
43989528 |
T |
|
| Q |
201 |
taagaagtatcttttaagaaacatgtctccttgggtttgttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43989529 |
taagaagtatcttttaagaaacatgtctccttgggtttgttt |
43989570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 66 - 128
Target Start/End: Complemental strand, 43918590 - 43918528
Alignment:
| Q |
66 |
gaagaagaataaggaaaaggtgtgggacgacatgatcgtaagtcaaagaaggagaacaaggca |
128 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||| ||| ||||||| |||||| |
|
|
| T |
43918590 |
gaagaagaataaggagaaggcatgggacgacatgatcgtaggtcgaaggaggagaagaaggca |
43918528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University