View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12033_high_25 (Length: 253)
Name: NF12033_high_25
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12033_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 30393588 - 30393349
Alignment:
| Q |
1 |
taggtaaagaaaatctgtaacaagagtatgggatgcttgtcccacaaagttgatgtttaattcatcttctaaaaacgaatttgaaattatgacacaaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30393588 |
taggtaaagaaaatctgtaacaagagtatgggatgcttgtcccacaaagttgatgtttaattcatcttctaaaaacgaatttgaaattatgacacaaagg |
30393489 |
T |
|
| Q |
101 |
taaaaggtcagagagataggggacctcaaaagccctaaaataggtaaattttagtatgggttgctcccccattcccacaccattaggtgtgagtttatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30393488 |
taaaaggtcagagagataggggacctcaaaagccttaaaataggtcaattttagtatgggttgctcccccattcccacaccattaggtgtgagtttatgg |
30393389 |
T |
|
| Q |
201 |
tagttacta----gcacctagctaactcaatagtaccatg |
236 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30393388 |
tagttactagcatgcacctagctaactcaatagtaccatg |
30393349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University