View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12033_high_26 (Length: 251)
Name: NF12033_high_26
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12033_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 30667680 - 30667579
Alignment:
| Q |
1 |
aacttaatgttaagagagaattgtggtatgcagagaaatggacggatcaattgtaaagcataattctcaacttatagtagatagactagaaggtagtaca |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30667680 |
aacttaatgttaagagagaattgcggtatgcagagaaatggacgaatcaattgtaaagcataattctcaacttatagtagatagactagaaggtagtaca |
30667581 |
T |
 |
| Q |
101 |
at |
102 |
Q |
| |
|
|| |
|
|
| T |
30667580 |
at |
30667579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 166 - 232
Target Start/End: Complemental strand, 30667515 - 30667449
Alignment:
| Q |
166 |
ggaattccgagaaaatcagaggggaagagaaattagaacattacaccaattccatgaccactttacc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30667515 |
ggaattccgagaaaatcagaggggaagagaaattagaacattacaccaattccatgacaactttacc |
30667449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University