View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12033_high_27 (Length: 250)
Name: NF12033_high_27
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12033_high_27 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 20 - 250
Target Start/End: Original strand, 12273956 - 12274166
Alignment:
| Q |
20 |
gttgagtaatgtaaaagacaaaaaatagaggtgaaggtagttattgttattttgagttacctgtcccagttgatgtctgtatcggacagcgcgaactgtg |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12273956 |
gttgagtaatgttaaagacaaaaaatagaggtgaaggtagttattgttattttgagttacctgtcccagttgatgtctgtatcggacagcgcgaactgtg |
12274055 |
T |
 |
| Q |
120 |
gagtggtggcagcctcggtgtccatggctgtaacaattatttgaacgaacctgtcttactatatattttgtgtttgttgtgtttcacagagatgaatgac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12274056 |
gagtggtggcagcctcggtgtccatggctataacaattatttgaacgaacctgtc------------------ttgttgtgtttcacagagatgaatgac |
12274137 |
T |
 |
| Q |
220 |
acactctctttcgtgttaacagaggaacatt |
250 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
12274138 |
aca--ctctttcgtgttaacagaggaacatt |
12274166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University