View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12033_low_28 (Length: 250)
Name: NF12033_low_28
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12033_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 34 - 240
Target Start/End: Complemental strand, 10337000 - 10336794
Alignment:
| Q |
34 |
gtcaatagacttaactttctttcataacttagtctggaatattaattttcatattgttattaatggaaaatagcacctaggttttgttatttttaaaact |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10337000 |
gtcaatagacttaactttctttcataacttagtctggaatattaattttcatattgttattaatggaaaatagcacataggttttgttatttttaaaact |
10336901 |
T |
|
| Q |
134 |
ataagcacgaccaaagctcacacaaattaaaactatataaatttttaatcatacttagatcacttgtttctttttcaataattcaacataaatttttgtt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10336900 |
ataagcacgaccaaagctcacacaaattaaaactatataaattcttaatcatactcagatcacttgtttctttttcaataattcaacacaaatttttgtt |
10336801 |
T |
|
| Q |
234 |
catctca |
240 |
Q |
| |
|
|||||| |
|
|
| T |
10336800 |
tatctca |
10336794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University