View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12033_low_29 (Length: 242)
Name: NF12033_low_29
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12033_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 16 - 226
Target Start/End: Original strand, 41210662 - 41210869
Alignment:
| Q |
16 |
cacttgattttattccagtttgtttcggtcactgcactagtaacaaaataaaaannnnnnnnnnnnncatcaaaagggtattgattaacttttatcgtat |
115 |
Q |
| |
|
||||||||||||||| ||||||||| ||||| || ||||||||||||||||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
41210662 |
cacttgattttattcgagtttgttttggtcattggactagtaacaaaataaaaaaatatatatat---atcaaaatggtattgattaatttttatcgtat |
41210758 |
T |
 |
| Q |
116 |
tgaatttgannnnnnnnncttacactaaatttagggtgagagaatgaagttccattataatataaagaaaacattcggattcgaaaaacatttataaagg |
215 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41210759 |
tgaatttaatttttttttcttacactaaatttagggtgagagaatgaagttcctttataatataaagaaaacatttggattcgaaaaacatttataaagg |
41210858 |
T |
 |
| Q |
216 |
tatttatattt |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
41210859 |
tatttatattt |
41210869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University