View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12033_low_30 (Length: 229)
Name: NF12033_low_30
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12033_low_30 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 10337470 - 10337248
Alignment:
| Q |
7 |
gatccttccaaagagagagtactattaaagtattcgggctttggtgctatgcaattttgtggcatggttaaagaaaaagaaggagaaaaagtgagagtag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10337470 |
gatccttccaaagagagagtactattaaagtattctggctttggtgctatgcaattttgtggcatggttaaagaaaaagaaggagaaaaagtgagagtag |
10337371 |
T |
|
| Q |
107 |
tgataattgacaataagttgtgatatgaggtgatgattgagaacttaaagaagttaagaagttccttttaacttaacaccttaatgtgtagtgaggagaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10337370 |
tgataattgacaataagttgtgatatgaggtgatgattgagaacttaaagaagttaagaagttccttttaacttaacaccttaatgtgtagtgaggagaa |
10337271 |
T |
|
| Q |
207 |
gcacataaatatatagccttctt |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10337270 |
gcacataaatatatagccttctt |
10337248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University