View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12033_low_32 (Length: 203)
Name: NF12033_low_32
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12033_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 14 - 184
Target Start/End: Complemental strand, 12473968 - 12473791
Alignment:
| Q |
14 |
caaagggggtgaagtttttagggtttagagaatgtgtccctttaacgatcaaatgtccttaattataaggaagactgtagaattttcctgtcagaataat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
12473968 |
caaagggggtgaagtttttagggtttagagaatgtgtccctttaacgatcatctgtccttaattataaggaagactgtagaattttcctgtcggaatcat |
12473869 |
T |
|
| Q |
114 |
tgattttgttagactgtcctcgacgt-------agatcaacatttgatcaccattaccggattctcttgggtgctccc |
184 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12473868 |
tgattttgttagactgtcctcgacgttatttgcatatcaacatttgatcaccattaccggattctcttgggtgctccc |
12473791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University