View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12033_low_4 (Length: 455)
Name: NF12033_low_4
Description: NF12033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12033_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 421; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 421; E-Value: 0
Query Start/End: Original strand, 17 - 449
Target Start/End: Complemental strand, 24056765 - 24056333
Alignment:
| Q |
17 |
agtttacatttgctgctgtctgcgcttttctttaggaagtgttttctgttgtgagtggttttagcaggagatatataacagcatcagtattgtgcctctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24056765 |
agtttacatttgctgctgtctgcgcttttctttaggaagtgttttctgttgtgagtggttttagcaggagatatataacagcatcagtattgtgcctctg |
24056666 |
T |
 |
| Q |
117 |
ctactggtgtgtcttttgcggtttccacggctaggagttctttggccgctcaggctcttgggtttataggtttccggttatttcagtgcctttttaattg |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24056665 |
ctactggtgtatcttttgcggtttccacggctaggagttctttggccgctcaggctcttgggtttataggtttccggttatttcagtgcctttttaattg |
24056566 |
T |
 |
| Q |
217 |
tctttatttcgctgcgagtattttggtgcaacttgcacttgctcgacgagaataaatttgataacaaactaagtgtgtctctagatgagttgaataatat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24056565 |
tctttatttcgctgcgagtattttggtgcaacttgcacttgctcgacgagaataaatttgataacaaactaagtgtgtctctagatgagttgaataatat |
24056466 |
T |
 |
| Q |
317 |
tagttaaactgaatatatgaatctcttaattttgttttaagctgaccaaagaaatcattttttatgattctattatttatatcaatatgcttcaaaatga |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24056465 |
tagttaaactgaatatatgaatctcttaattttgttttaagctgaccaaagaaatcattttttatgattctattatttatatcaataagcttcaaaatga |
24056366 |
T |
 |
| Q |
417 |
agctaagagactcaagagtcacacctatgcttc |
449 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
24056365 |
agctaagagactcaagagtcacacccatgcttc |
24056333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University