View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12034_high_17 (Length: 251)
Name: NF12034_high_17
Description: NF12034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12034_high_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 42189057 - 42188817
Alignment:
| Q |
11 |
cagagatagatgttgttgcactcctaatatcactatctccttgtaaaacatatcttaaacgtgcttcaagccgattaattttctgagaatcctcaataga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42189057 |
cagagatagatgttgttgcactcctaatatcactatctccttgtaaaacatatcttaaacgtgcttcaagccgattaattttctgagaatcctcaataga |
42188958 |
T |
 |
| Q |
111 |
tgtcccagtgatgctgtctttaacataaattaaggaggccgttcggccattgtgagtccaaactttagcctccactacatcacattgcagctcggccaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42188957 |
tgtcccagtgatgctgtctttaacataaattaaggaggccgttcggccattgtgagtccaaactttagcctccaccacatcacattgcagctcggccaaa |
42188858 |
T |
 |
| Q |
211 |
acagcaaacacctcagaaagaagaccaacgcgatccgtgcc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42188857 |
acagcaaacacctcagaaagaagaccaacgcgatccgtgcc |
42188817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University