View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12034_high_20 (Length: 237)
Name: NF12034_high_20
Description: NF12034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12034_high_20 |
 | |
|
| [»] scaffold1519 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold1519 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: scaffold1519
Description:
Target: scaffold1519; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 66 - 237
Target Start/End: Complemental strand, 258 - 87
Alignment:
| Q |
66 |
ccctgagtttgtggggggaaggataaggtctatagagtacttaaactcgttaatattgtatttctgccagctttgcagttagttacacttccatttgtat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
258 |
ccctgagtttgtggggggaaggataaggtctatagagtacttaaactcgttaatattgtatttctgccagctttgcagttagttacactcccatttgtat |
159 |
T |
|
| Q |
166 |
gccagctcatcagttggttacatttgtctttctgttgaaggcagttgcaaactgtacgaaattattgtatcc |
237 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
158 |
gccagctcatcagttggttacagttgtctttctgttgaaggcagttgcaaactgtacgaaattattgtatcc |
87 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1519; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 433 - 365
Alignment:
| Q |
1 |
aggtaactgaacattttctttgtgggagaaaaggttcttagcaagtccttaattgtttcctatgtccct |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
433 |
aggtaactgaacattttctttgtgggagaaagggttcttagcaagtccttaattgtttcctatgtccct |
365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University