View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12034_high_21 (Length: 234)
Name: NF12034_high_21
Description: NF12034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12034_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 4004428 - 4004645
Alignment:
| Q |
1 |
tatgatcacgaccgttgcttttgtcatttttcaaaccagactctatttcctcaaaacacgagtaacacgaaaaatcaaagtttgcttataatcccacgtt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4004428 |
tatgatcacgaccgttgcatttgtcatttttcaaaccagactctatttcctcaaaacacgagtaacacgaaaaatcaacgtttgcttataatcccacgtt |
4004527 |
T |
 |
| Q |
101 |
tcattcccatcaggtttgtacgtgacttttgtttggtatttaccaacaagtagcttttgtaatttaagattgtcttgaacatgtaattttaattgacatt |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4004528 |
tcattcccattaggtttgtacgtgacttttgtttggtatttaccaacaagtagcttttgtaatttaagattgtcttgaacatgtaattttaattgacatt |
4004627 |
T |
 |
| Q |
201 |
gtatataaactgtgatgt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4004628 |
gtatataaactgtgatgt |
4004645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University