View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12034_low_10 (Length: 372)
Name: NF12034_low_10
Description: NF12034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12034_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 218 - 325
Target Start/End: Original strand, 22883937 - 22884048
Alignment:
| Q |
218 |
ctcagaatcttcatcttag--tg--ttccaaatatggaggatattatctcaattcatgatagtttgctgagaagatttcatatatttatctaatcttcat |
313 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| | |||||| ||| ||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22883937 |
ctcagaatcttcatcttaggctggcttccaaatatgaatgatattttctacattcatggtagtttgctgagaagatttcatctatttatctaatcttcat |
22884036 |
T |
 |
| Q |
314 |
cgaattcggcaa |
325 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22884037 |
cgaattcggcaa |
22884048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 73 - 136
Target Start/End: Original strand, 22883702 - 22883765
Alignment:
| Q |
73 |
gtcttatagtgacattgcttaaaaaatgttgcatgcacgcatttaaatatatacttcaacattt |
136 |
Q |
| |
|
||||||| || ||||| ||||||||||||||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
22883702 |
gtcttatggtaacatttcttaaaaaatgttgcatgcacttattttaatatgtacttcaacattt |
22883765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Original strand, 22883888 - 22883926
Alignment:
| Q |
140 |
atcataaattcttcaccatcatcatcaatcgctcaattc |
178 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
22883888 |
atcatcaattcttcaccatcatcatcaatcgcccaattc |
22883926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 213 - 271
Target Start/End: Original strand, 30947274 - 30947332
Alignment:
| Q |
213 |
tttgcctcagaatcttcatcttagtgttccaaatatggaggatattatctcaattcatg |
271 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
30947274 |
tttgtctcagaatcttcatcttagggttccaaatatcaaggatattttctcaattcatg |
30947332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University