View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12034_low_25 (Length: 219)
Name: NF12034_low_25
Description: NF12034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12034_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 10 - 203
Target Start/End: Complemental strand, 377168 - 376975
Alignment:
| Q |
10 |
gaagcaaaggagagatttggaattgtgcctcagattgagcattatggttgtatgattgatcttttaggaagagctggacgcttggatgaggctgaaaaat |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
377168 |
gaagcaatggagagatttggaattgtgcctcagattgagcattatggttgtatgattgatcttttaggaagagctggacgcttggatgaggctgaaaaat |
377069 |
T |
 |
| Q |
110 |
tgattcaggccatgccttatgatcctaacgagataatactgacttcgtttctgtttgcttgttgttacttcgaagatgtttcaagggctgaaag |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
377068 |
tgattcaggccatgccttatgatcctaacgaaataatactgacttcgtttctgtttgcttgttgttacttcgaagatgtttcaagggctgaaag |
376975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 11 - 203
Target Start/End: Complemental strand, 1090309 - 1090123
Alignment:
| Q |
11 |
aagcaaaggagagatttggaattgtgcctcagattgagcattatggttgtatgattgatcttttaggaagagctggacgcttggatgaggctgaaaaatt |
110 |
Q |
| |
|
|||||| |||||| ||||||||||| | |||||||||||||||||||||||||||||||||| ||||||| | | | ||||||||||||||||||| || |
|
|
| T |
1090309 |
aagcaatggagaggtttggaattgtacatcagattgagcattatggttgtatgattgatcttctaggaaggtccgaatgcttggatgaggctgaaaattt |
1090210 |
T |
 |
| Q |
111 |
gattcaggccatgccttatgatcctaacgagataatactgacttcgtttctgtttgcttgttgttacttcgaagatgtttcaagggctgaaag |
203 |
Q |
| |
|
||||| || ||||| ||| | |||||||| ||||||| ||||| ||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1090209 |
tattcaagctatgcc-aatg-----agatagataatattgacttcatttctattttcttgttgttacttcgaagatgtttcgagggctgaaag |
1090123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 27037803 - 27037746
Alignment:
| Q |
18 |
ggagagatttggaattgtgcctcagattgagcattatggttgtatgattgatctttta |
75 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27037803 |
ggagagatttgaaattgtgcctcagattgagcattatggttgtatgattgatctttta |
27037746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University