View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12036_low_3 (Length: 237)
Name: NF12036_low_3
Description: NF12036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12036_low_3 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 98 - 237
Target Start/End: Complemental strand, 50465967 - 50465828
Alignment:
| Q |
98 |
tcaacaaattgaaattcatcaacttaatttaaagtcaactcgattcattccaacaaaagtaagcacaagggccttatcgagagaattggtcaactttggg |
197 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50465967 |
tcaagaaattgaaattcatcaacttaatttaaagtcaactcgattcattccaacaaaagtaagcacaagggccttatcgagaggattggtcaactttggg |
50465868 |
T |
 |
| Q |
198 |
aaatggatatattgatgatcataaattgagaaacaatgca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50465867 |
aaatggatatattgatgatcataaattgagaaacaatgca |
50465828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 50466105 - 50466041
Alignment:
| Q |
1 |
cctgtacctcaaaccacaacccaaatttgtgtgcattttgcacataaaattagaactactaaacc |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50466105 |
cctgtacctcaaaccacaacccaaatttgtgtgcattttgcacataaaattagaactactaaacc |
50466041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University