View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12038_high_16 (Length: 229)
Name: NF12038_high_16
Description: NF12038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12038_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 34304194 - 34304124
Alignment:
| Q |
1 |
tcaaacagcatcaaccggagcctaaaccggaaccggtacccgaacccgaacctgaaccatacatcccgggc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34304194 |
tcaaacagcatcaaccggagcctaaaccggaaccggtacccgaacccgaacctgaaccatacatcccgggc |
34304124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University