View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12038_high_17 (Length: 226)
Name: NF12038_high_17
Description: NF12038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12038_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 16986192 - 16986147
Alignment:
| Q |
18 |
taattgagataagttagaatgtaattgccttatataagtttcaaat |
63 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16986192 |
taattgaaataagttagaatgtaattgccttatataagttttaaat |
16986147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 158
Target Start/End: Original strand, 30131115 - 30131157
Alignment:
| Q |
116 |
gtgacacgagaagtttagggacgacaatagatacaaacaatgt |
158 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
30131115 |
gtgacacgagaagtttagggacaacaatagatacaaacgatgt |
30131157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University