View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12038_low_11 (Length: 286)
Name: NF12038_low_11
Description: NF12038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12038_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 4 - 271
Target Start/End: Complemental strand, 51263095 - 51262827
Alignment:
| Q |
4 |
ataggtgccaatggagcatctaatatgcaataaatcttaaatgtttaaaattctctcattaaagatggtgtaaggactcnnnnnnnnnnnnnnnnaatca |
103 |
Q |
| |
|
||||||| ||||||||||||||||| ||||| |||||||||| ||||||| |||| |||||||||||||||||||||| | | | |
|
|
| T |
51263095 |
ataggtgtcaatggagcatctaataggcaatgaatcttaaatatttaaaactctcccattaaagatggtgtaaggactttttttagtgttctttaact-a |
51262997 |
T |
|
| Q |
104 |
aggtctt-ggatttgaattt-aactctaaaattatttggaagatatcgggtcttaaaaaagaattttatgtattaagtaagtactaatatttaatataaa |
201 |
Q |
| |
|
||||||| |||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51262996 |
aggtctttggatttgaattttaacactaaaattatttggaagatattgggtcttaaaaaagaattttatgtattaagtaaggactaatatttaatataaa |
51262897 |
T |
|
| Q |
202 |
tattatttgcggtgtattgttgtgtttgtgtcgggatatttttgaggtgaagacaggaggtgttttattt |
271 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51262896 |
tattatttgcggtgtattgctgtgtttgtgtcgggatatttttgaggtgaagacaggaggtgttatattt |
51262827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University