View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12038_low_17 (Length: 237)
Name: NF12038_low_17
Description: NF12038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12038_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 38398131 - 38397972
Alignment:
| Q |
1 |
ccctcatcgttttaaaacacacactcccctcccttaacttttaaataaaatacacattagttatttttattaactttccgttaaagaccaaacagtctcc |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
38398131 |
ccctcattgttttaaaacacacactcccctaccttaacttttaaataaaatacacattagttatttttattaactttccattaaagaccaaatagtctcc |
38398032 |
T |
|
| Q |
101 |
gataaaaattgtattattaccaaaataacctccgatcgtctctcgtgactgtcatcttcc |
160 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38398031 |
gttaaaaattgtattattacgaaaataacctccgatcgtctctcgtgactgtcatcttcc |
38397972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 182 - 217
Target Start/End: Complemental strand, 38397953 - 38397918
Alignment:
| Q |
182 |
catcatctacgaccaactctttgcctgcacaaactc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38397953 |
catcatctacgaccaactctttgcctgcacaaactc |
38397918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University