View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12038_low_18 (Length: 229)

Name: NF12038_low_18
Description: NF12038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12038_low_18
NF12038_low_18
[»] chr7 (1 HSPs)
chr7 (1-71)||(34304124-34304194)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 34304194 - 34304124
Alignment:
1 tcaaacagcatcaaccggagcctaaaccggaaccggtacccgaacccgaacctgaaccatacatcccgggc 71  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34304194 tcaaacagcatcaaccggagcctaaaccggaaccggtacccgaacccgaacctgaaccatacatcccgggc 34304124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University