View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12038_low_19 (Length: 226)

Name: NF12038_low_19
Description: NF12038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12038_low_19
NF12038_low_19
[»] chr5 (2 HSPs)
chr5 (18-63)||(16986147-16986192)
chr5 (116-158)||(30131115-30131157)


Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 16986192 - 16986147
Alignment:
18 taattgagataagttagaatgtaattgccttatataagtttcaaat 63  Q
    ||||||| ||||||||||||||||||||||||||||||||| ||||    
16986192 taattgaaataagttagaatgtaattgccttatataagttttaaat 16986147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 158
Target Start/End: Original strand, 30131115 - 30131157
Alignment:
116 gtgacacgagaagtttagggacgacaatagatacaaacaatgt 158  Q
    |||||||||||||||||||||| ||||||||||||||| ||||    
30131115 gtgacacgagaagtttagggacaacaatagatacaaacgatgt 30131157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University