View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12038_low_20 (Length: 214)

Name: NF12038_low_20
Description: NF12038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12038_low_20
NF12038_low_20
[»] chr1 (1 HSPs)
chr1 (1-202)||(25583477-25583678)
[»] chr4 (1 HSPs)
chr4 (80-116)||(41696776-41696812)


Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 25583477 - 25583678
Alignment:
1 ggattgactgtgagttttttattaccgtaattttggcaaaaacttcattttgaagcttcaaccaaacgacggcgctactgtgatttcgttaaactcactg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25583477 ggattgactgtgagttttttattaccgtaattttggcaaaaactacattttgaagcttcaaccaaacgacggcgctactgtgatttcgttaaactcactg 25583576  T
101 taattccaaacatgcagttaattcctccttttggagttgttgttttcatgatggaaatcaagtaaaacagtgcttttgcatttagggcactttggatcat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
25583577 taattccaaacatgcagttaattcctccttttggagttgttgttttcatgatggaaatcaagtaaaacagtgcttttacatttagggcactttggatcat 25583676  T
201 ct 202  Q
    ||    
25583677 ct 25583678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 116
Target Start/End: Original strand, 41696776 - 41696812
Alignment:
80 gtgatttcgttaaactcactgtaattccaaacatgca 116  Q
    |||||||||||||||||||||| ||||||||||||||    
41696776 gtgatttcgttaaactcactgtcattccaaacatgca 41696812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University