View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12038_low_20 (Length: 214)
Name: NF12038_low_20
Description: NF12038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12038_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 25583477 - 25583678
Alignment:
| Q |
1 |
ggattgactgtgagttttttattaccgtaattttggcaaaaacttcattttgaagcttcaaccaaacgacggcgctactgtgatttcgttaaactcactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583477 |
ggattgactgtgagttttttattaccgtaattttggcaaaaactacattttgaagcttcaaccaaacgacggcgctactgtgatttcgttaaactcactg |
25583576 |
T |
 |
| Q |
101 |
taattccaaacatgcagttaattcctccttttggagttgttgttttcatgatggaaatcaagtaaaacagtgcttttgcatttagggcactttggatcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25583577 |
taattccaaacatgcagttaattcctccttttggagttgttgttttcatgatggaaatcaagtaaaacagtgcttttacatttagggcactttggatcat |
25583676 |
T |
 |
| Q |
201 |
ct |
202 |
Q |
| |
|
|| |
|
|
| T |
25583677 |
ct |
25583678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 116
Target Start/End: Original strand, 41696776 - 41696812
Alignment:
| Q |
80 |
gtgatttcgttaaactcactgtaattccaaacatgca |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41696776 |
gtgatttcgttaaactcactgtcattccaaacatgca |
41696812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University