View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12038_low_22 (Length: 206)
Name: NF12038_low_22
Description: NF12038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12038_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 25583679 - 25583869
Alignment:
| Q |
1 |
tcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctgttagagtatctctgttggttgtttccatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583679 |
tcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctgttagagtatctctgttggttgtttccatctt |
25583778 |
T |
|
| Q |
101 |
cttggtttagctcagtggacacacatgaacttggtggggatgtaggtgacactgttgctgatcttgttggtgatgactcaactcttctgtg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25583779 |
cttggtttagctcagtggacacacatgaacttggtggggatgtaggtgacactgttgctgatcttgttggtgatgactcaactcttctgtg |
25583869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 42894143 - 42894075
Alignment:
| Q |
1 |
tcagaaagcatgacatacataagacaacgaggacaaccaaccaaaaccatggaagtggcttctgggctg |
69 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||||||| || || | |||||| || ||||| |||||| |
|
|
| T |
42894143 |
tcagagagcatcacatacatgagacaacgaggacaacctactaacagcatggaggttgcttcagggctg |
42894075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University