View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12039_high_39 (Length: 251)
Name: NF12039_high_39
Description: NF12039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12039_high_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 36689967 - 36689757
Alignment:
| Q |
22 |
tgtgcacttcaagcactttagttcccttgaattaagaccaatttttcaaaatggtgtcaccaaatgttgaatccactacagcagactccacacatacctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36689967 |
tgtgcacttcaagcactttagttcccttgaattaagaccaatttttcaaaatggtgtcaccaaatgttgaatccactacagcagactccacatatacctt |
36689868 |
T |
|
| Q |
122 |
tcgaaacttggttaagaaatcatgggctaagttagtgaaggtcataaatatggtaaaagagattggccaagatgaccctagaagggttattcattccttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36689867 |
tcgaaacttggttaagaaatcatgggctaagttagtgaaggtcataaatatggtaaaagagattggccaagatgaccctagaagggttattcattccttc |
36689768 |
T |
|
| Q |
222 |
aaagtcggatt |
232 |
Q |
| |
|
||||||||||| |
|
|
| T |
36689767 |
aaagtcggatt |
36689757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University