View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12039_low_20 (Length: 382)
Name: NF12039_low_20
Description: NF12039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12039_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 375
Target Start/End: Complemental strand, 30778742 - 30778368
Alignment:
| Q |
1 |
tgtgatctttgactgcatggtgcaagtttgtgggttaggttttggcgtctttttgatttacgtttgataaagatgttaccttagtggagattaggaggct |
100 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30778742 |
tgtgatctttgactgcatggtgaaggtttgtgggttaggttttggcgtccttttgatttacgtttgataaaggtgttaccttagtggagattaggaggct |
30778643 |
T |
 |
| Q |
101 |
agcatgggggattgataggctagggtaaccgtggaagaagacgtctccatgtgatttagttgtcggttgtttaaga-gtttggaaggacaagaatagtcg |
199 |
Q |
| |
|
|||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
30778642 |
agcatgggggattgataggctaggatagcggtggaagaagacgtctccatgtgatttagttgtcggttgtttaagatatttggaaggataagaatagtcg |
30778543 |
T |
 |
| Q |
200 |
tatttttcgacatatagatcaatcgatacagcaaccggtgaacatcgtgaagttttcttcttttagatggttacaatcgaaaattaacaacttagccttt |
299 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
30778542 |
tatttttcgacatataga-caatcgatacaacaaccggtgaatatcgtgaaattttcttcttttagatggttacaaccgaaaattaacaacttagctttt |
30778444 |
T |
 |
| Q |
300 |
gattttcatcatcggtggacaagcaaaaattgcaacttagcttttgattttcatcattggtggacaaatctcattg |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30778443 |
gattttcatcatcggtggacaagcaaaaattgcaacgtagcttttgattttcatcatcggtggacaaatctcattg |
30778368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University