View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12039_low_28 (Length: 328)
Name: NF12039_low_28
Description: NF12039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12039_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 68 - 306
Target Start/End: Complemental strand, 4444982 - 4444749
Alignment:
| Q |
68 |
gtgagtttcttagagggatgatgttgacaaacaaggaattagcaatgatcattaacgacaataaacagaagaggcctctgtgtgtccggtgactctaact |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4444982 |
gtgagtttcttagagggatgatgttgacaaacaaggaa---gcaatgatcattaacgacaataaacagaagaggcctc-gtgtgtccggtgactctaact |
4444887 |
T |
|
| Q |
168 |
gtgtaacttcgcaacctctaacaaattactcttttgtcaacaaagcagccgcaaacgtggctttttgaaatgaatgaaaaaacattcaagaatccctttt |
267 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
4444886 |
gtgtaactttgcaacctctaacaaattactcttttgtcaacaacgcagccgcaaacgtggc-ttttgaaatgactgaaaaaacattcaagaatcccttct |
4444788 |
T |
|
| Q |
268 |
tcccggttgatttcgatacttactgatcgttagcagtcg |
306 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4444787 |
tcccagttgatttcgatacttactgatcgttagcagtcg |
4444749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 4445055 - 4445016
Alignment:
| Q |
1 |
acagaaaaatcaaacaatggaaggaaacaagactatggtt |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4445055 |
acagaaaaatcaaacaatggaaggaaacaagactatggtt |
4445016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 168 - 299
Target Start/End: Original strand, 37558480 - 37558610
Alignment:
| Q |
168 |
gtgtaacttcgcaacctctaacaaattactcttttgtcaacaaagcagccgcaaacgtggctttttgaaatgaatgaaaaaacattcaagaatccctttt |
267 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||| ||||| | | |||| ||| |||||| ||||||| || ||||| ||||||| | |
|
|
| T |
37558480 |
gtgtaacttcgcaacctctaccaaattattcttttgtcaacaatgcagctgtggagttggc-tttcaaaatgactgaaaaatcactcaaggatcccttct |
37558578 |
T |
|
| Q |
268 |
tcccggttgatttcgatacttactgatcgtta |
299 |
Q |
| |
|
|||| |||||||| |||||||| || |||||| |
|
|
| T |
37558579 |
tcccagttgatttggatacttattgttcgtta |
37558610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University