View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12039_low_35 (Length: 290)
Name: NF12039_low_35
Description: NF12039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12039_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 17 - 270
Target Start/End: Complemental strand, 44237670 - 44237417
Alignment:
| Q |
17 |
gaatgcggcaaaatctaaactttctaccatatttcatatatttctgaggtattgtcggttttgagcctcttgtgtcagcactcacaactgtcctttggta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44237670 |
gaatgcggcaaaatctaaactttctaccatatttcatatatttctgaggtattgtcggttttgagcctcttgtgtcagcactcacgactgtcctttggta |
44237571 |
T |
|
| Q |
117 |
aaaggtgcattgagggatagatgagtgcgagtgcttatttaaactaaactatgcctcgattctcaagtgatgtgggatttttggttgatcggaacaaata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44237570 |
aaaggtgcattgagggatagatgagtgcgagtgcttatttaaactaaactatgcctcgattctcaagtgatgtgggatttttggttgatcggaacaaata |
44237471 |
T |
|
| Q |
217 |
ccattcccgttactctataagtatccagtttgaacaagagataatacataaatt |
270 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44237470 |
ccattcccgttactctataagcatccagtttgaacaagagataatacataaatt |
44237417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University