View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12039_low_42 (Length: 239)
Name: NF12039_low_42
Description: NF12039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12039_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 38094795 - 38094568
Alignment:
| Q |
1 |
tgagtggactacatttttatctaccagttactctctgtttgcagctggtttatatcactgtctcccccattccgtgatcaattgcttttacaaatcctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38094795 |
tgagtggactacatttttatctaccagttactctctgtttgcagctggtttatatcactgtctcccccattccgtgatcaattgcttttacaaatcctat |
38094696 |
T |
 |
| Q |
101 |
agcaagagaaaa-----aaggattggagggaccattgctcccgactagagtatactctcatatggaactcactcacgtgtccacttaaacctaggacatt |
195 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38094695 |
agcaagagaaaaaagctaaggattggagggaccattgctcccgactagagtatactctcgtatggaactcactcacgtgtccacttaaacctaggacatt |
38094596 |
T |
 |
| Q |
196 |
attgtcaaacctataataaatagagata |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38094595 |
attgtcaaacctataataaatagagata |
38094568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University