View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12039_low_42 (Length: 239)

Name: NF12039_low_42
Description: NF12039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12039_low_42
NF12039_low_42
[»] chr8 (1 HSPs)
chr8 (1-223)||(38094568-38094795)


Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 38094795 - 38094568
Alignment:
1 tgagtggactacatttttatctaccagttactctctgtttgcagctggtttatatcactgtctcccccattccgtgatcaattgcttttacaaatcctat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38094795 tgagtggactacatttttatctaccagttactctctgtttgcagctggtttatatcactgtctcccccattccgtgatcaattgcttttacaaatcctat 38094696  T
101 agcaagagaaaa-----aaggattggagggaccattgctcccgactagagtatactctcatatggaactcactcacgtgtccacttaaacctaggacatt 195  Q
    ||||||||||||     |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
38094695 agcaagagaaaaaagctaaggattggagggaccattgctcccgactagagtatactctcgtatggaactcactcacgtgtccacttaaacctaggacatt 38094596  T
196 attgtcaaacctataataaatagagata 223  Q
    ||||||||||||||||||||||||||||    
38094595 attgtcaaacctataataaatagagata 38094568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University