View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1203_high_1 (Length: 295)
Name: NF1203_high_1
Description: NF1203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1203_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 74 - 230
Target Start/End: Complemental strand, 37967395 - 37967226
Alignment:
| Q |
74 |
gaattggtgaaacgtgattatgaaggagagtgagatgtcacttgttgcgtgatggtgaggtgtgaatgtgaaatggtgaagagtgatta----------- |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
37967395 |
gaattggtgaaacgtgattatgaaggagagtgagatgtcacttgttgcgtgatgtttaggtgtgaatgtgaaatggtgaaaagtgattatgaaaagtgat |
37967296 |
T |
|
| Q |
163 |
--tgaacgaacgtgatttacctgaggcgatgaaaatgaggaacgcggagtgtgaagcgtgaatgatgatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37967295 |
tatgaacgaacgtgatttacctgaggcgatgaaaatgaggaacgcggagtgtgaagcgtgaatgatgatg |
37967226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University