View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1203_high_6 (Length: 251)
Name: NF1203_high_6
Description: NF1203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1203_high_6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 4 - 251
Target Start/End: Complemental strand, 40429651 - 40429403
Alignment:
| Q |
4 |
gcagcacca-cagaccctaaaaatcgttgcttctctccgaagcagacgacagcaggggtttcacggttcgattcattattcaacaaaacatcaaccccac |
102 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40429651 |
gcagcaccagcagaccctaaaaatcgttgcttctctccgaagcagacgacagcaggggtttcacggttcgattcattattcagcaaaacatcaaccccac |
40429552 |
T |
|
| Q |
103 |
cttgcttcgctacagcaatgacacaattctcattaccaatgtcaaaccctactacactcatttcaactcactgaatccctttaccaataaccctaaatac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40429551 |
cttgcttcgctacagcaatgacacaattctcattaccaatgtcaaaccctactacactcatttcaactcactgaatccctttaccaataaccctaaatat |
40429452 |
T |
|
| Q |
203 |
aaaaccttcacaatattctacaacaaagctggcacagaatcataagctt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40429451 |
aaaaccttcacaatattctacaacaaagctggcccagaatcataagctt |
40429403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 3 - 173
Target Start/End: Complemental strand, 20258112 - 20257941
Alignment:
| Q |
3 |
agcagcacca-cagaccctaaaaatcgttgcttctctccgaagcagacgacagcaggggtttcacggttcgattcattattcaacaaaacatcaacccca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| || |||||||| || |||||||| |||||||||||||| || || ||||||| ||||||||||||||||| ||| |
|
|
| T |
20258112 |
agcagcaccagcagaccctaaaaaccgctgcttctcgccaaagcagacaacagcaggggtttcccgctttgattcatcattcaacaaaacatcaatcccg |
20258013 |
T |
|
| Q |
102 |
ccttgcttcgctacagcaatgacacaattctcattaccaatgtcaaaccctactacactcatttcaactcac |
173 |
Q |
| |
|
| ||||| || |||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20258012 |
cgatgctttgccacagcaataacacagttctcattaccaatgtcaaaccctaccacactcatttcaactcac |
20257941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University