View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1203_low_10 (Length: 295)

Name: NF1203_low_10
Description: NF1203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1203_low_10
NF1203_low_10
[»] chr2 (1 HSPs)
chr2 (74-230)||(37967226-37967395)


Alignment Details
Target: chr2 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 74 - 230
Target Start/End: Complemental strand, 37967395 - 37967226
Alignment:
74 gaattggtgaaacgtgattatgaaggagagtgagatgtcacttgttgcgtgatggtgaggtgtgaatgtgaaatggtgaagagtgatta----------- 162  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||               
37967395 gaattggtgaaacgtgattatgaaggagagtgagatgtcacttgttgcgtgatgtttaggtgtgaatgtgaaatggtgaaaagtgattatgaaaagtgat 37967296  T
163 --tgaacgaacgtgatttacctgaggcgatgaaaatgaggaacgcggagtgtgaagcgtgaatgatgatg 230  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37967295 tatgaacgaacgtgatttacctgaggcgatgaaaatgaggaacgcggagtgtgaagcgtgaatgatgatg 37967226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University