View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1203_low_15 (Length: 262)
Name: NF1203_low_15
Description: NF1203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1203_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 25926979 - 25927127
Alignment:
| Q |
1 |
tatgtagtaaaaacatttggaaactaaagataaatttgcattacaagaagattgagggagaaggtttttcatccctctcatgtgccgtatgaggaagata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||| ||| |
|
|
| T |
25926979 |
tatgtagtaaaaacatttggaaactaaagataaatttgcattacaagaagatcgagggagaaggtttttcatccctctcatgtgtcgtaggaggaatata |
25927078 |
T |
 |
| Q |
101 |
ggaacacaagatgattgagcaggagaaagttaaaattgatctaaacaat |
149 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25927079 |
ggaacacaagatgattgagtaggagaaagttaaaattgatctaaacaat |
25927127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University