View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1203_low_15 (Length: 262)

Name: NF1203_low_15
Description: NF1203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1203_low_15
NF1203_low_15
[»] chr3 (1 HSPs)
chr3 (1-149)||(25926979-25927127)


Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 25926979 - 25927127
Alignment:
1 tatgtagtaaaaacatttggaaactaaagataaatttgcattacaagaagattgagggagaaggtttttcatccctctcatgtgccgtatgaggaagata 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||| |||    
25926979 tatgtagtaaaaacatttggaaactaaagataaatttgcattacaagaagatcgagggagaaggtttttcatccctctcatgtgtcgtaggaggaatata 25927078  T
101 ggaacacaagatgattgagcaggagaaagttaaaattgatctaaacaat 149  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||    
25927079 ggaacacaagatgattgagtaggagaaagttaaaattgatctaaacaat 25927127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University