View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1203_low_18 (Length: 252)
Name: NF1203_low_18
Description: NF1203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1203_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 133 - 194
Target Start/End: Complemental strand, 53089964 - 53089903
Alignment:
| Q |
133 |
cgtattgtgaaacttcgtgaacccacttctcgctatataaagcattttcctactcaaattct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53089964 |
cgtattgtgaaacttcgtgaacccacttctcgctatataaagcattttcctactcaaattct |
53089903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University