View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1203_low_20 (Length: 249)
Name: NF1203_low_20
Description: NF1203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1203_low_20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 10 - 249
Target Start/End: Complemental strand, 3292564 - 3292325
Alignment:
| Q |
10 |
gcataggtgtgacatggaaaggtaaagtttacatcataggaggattcgctgaaagagaaaactctgatatgacaatgcctagtatagttgaacggagctc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3292564 |
gcataggtgtgacatggaaaggtaaagtttacatcataggaggattcgctgaaagagaaaactctgatatgacaatgcctagtatagttgaacggagctc |
3292465 |
T |
 |
| Q |
110 |
agctgaagttcttgactcgcaagcaagaaaatgggacctcattgtaggtatgtggcagctcgacgtgccacctaatcaaattgtggcggtgaatgacact |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3292464 |
agctgaggttcttgactcgcaagcaagaaaatgggacctcattgcaggaatgtggcagctcgacgtgccacctaatcaaattgtggcggtgaatgacact |
3292365 |
T |
 |
| Q |
210 |
ctttttagctcaggggattgtttgaatgcttggaaaggac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3292364 |
ctttttagctcaggggattgtttgaatgcttggaaaggac |
3292325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University