View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12040_high_22 (Length: 378)
Name: NF12040_high_22
Description: NF12040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12040_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 20 - 369
Target Start/End: Complemental strand, 52926133 - 52925784
Alignment:
| Q |
20 |
agttgaggatcgtgctcaccgctccgcaatcaccagagtaaatgctgatgatgttcgtgtcactgtagctgctcctgctgctcgtggagaagctaacaat |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926133 |
agttgaagatcgtgctcaccgctccgcaatcaccagagtaaatgctgatgatgttcgtgtcactgtagctgctcctgctgctcgtggagaagctaacaat |
52926034 |
T |
 |
| Q |
120 |
gaacttttggagtttatgggaaaggttttaggtttaagattgagtcaaatgactcttcagagaggatggaataacaagtcaaagcttcttgtggtcagtc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926033 |
gaacttttggagtttatgggaaaggttttaggtttaagattgagtcaaatgactcttcagagaggatggaataacaagtcaaagcttcttgtggtcagtc |
52925934 |
T |
 |
| Q |
220 |
atgtcttcttcaacttaaccaagtagtaagtatttctcaacaaacatatatactaacgctaattttcaccatcatttcaggtggaggatctcactgctag |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52925933 |
atgtcttcttcaacttaaccaagtagtaagtatttctcaacaaacatatatactaatgctaattttcaccatcatttcaggtggaggatctcactgctag |
52925834 |
T |
 |
| Q |
320 |
acaagtttatgagaaacttttggaggctgtgcaaccttgatgatgtccat |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52925833 |
acaagtttatgagaaacttttggaggctgtgcaaccttgatgctgtccat |
52925784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University