View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12040_high_24 (Length: 363)
Name: NF12040_high_24
Description: NF12040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12040_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 345
Target Start/End: Original strand, 41222850 - 41223188
Alignment:
| Q |
1 |
gaaggtgaaaaagggtctagagaaggaagaagaggttcatcaaatgggtttgaattttgttgagaagttacttcattagtactgtgatgagaattggtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41222850 |
gaaggtgaaaaagggtctagagaaggaagaagaggttcatcaaatgggtttgaattttgttgagaagttacttcattagtactgtgatgagaattggtga |
41222949 |
T |
|
| Q |
101 |
aaaaagggaaagagtctgagaaaaatggaaggtctccacttccatcatttgaagagactatttctgaggttgaatgtgtgtggaaagttgtggtgccgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41222950 |
aaaaagggaaagagtctgagaaaaatggaaggtctccacttccatcatttgaagagactatttctgaggttgaatgtgtgtggaaagttgtggtgccgaa |
41223049 |
T |
|
| Q |
201 |
tgaatatagttccgaagacatagaatcgaaaaattctattgaattgaattgaactcctttttaatgtgaatcaatatcctgcctctgcgcacgactgcag |
300 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||| |
|
|
| T |
41223050 |
tgaatatagttccgaagacatagaatcaaaaaattct-----attgaattgaactcctttttaatgtgaatcagtatccagcctttgcgcacgactgcag |
41223144 |
T |
|
| Q |
301 |
agactaattactcgaaccggataggatcacaaagggatcaaatct |
345 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41223145 |
agactaattcctcgaaccggataggatcacaaa-ggatcaaatct |
41223188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University