View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12040_high_31 (Length: 297)
Name: NF12040_high_31
Description: NF12040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12040_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 51305885 - 51305602
Alignment:
| Q |
1 |
acagtaatatgatcttattgcaaagtagttttgttcttttgattttcaattctgtaattaatctaattagacttggtttattccttttcacatgcaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51305885 |
acagtaatatgatcttattgcaaagtagttttgttcttttgattttcaattctgtaattaatctaattagacttggtttattccttttcacatgcaatct |
51305786 |
T |
 |
| Q |
101 |
aatgatgtatcatgtgactgactgacagctgaagagtgaaaattattggtggaatgattattgctttataacattttcccccctaaaataacacatttga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
51305785 |
aatgatgtatcatgtgactgactgacagctgaagagtgaaaattattggtggaatgattattgttttataacacttt-ccccctaaaataacacatttga |
51305687 |
T |
 |
| Q |
201 |
ttaaaaaacagttgagatgattggtggtgtacgttgttttcacatgtagacatactgcatgtttggtctttagatggtcggcctt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51305686 |
ttaaaaaacagttgagatgattggtggtgtacgttgttttcacatgtagacatactgcatgtttggtctttagatggtcggcctt |
51305602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University