View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12040_high_42 (Length: 229)
Name: NF12040_high_42
Description: NF12040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12040_high_42 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 88 - 229
Target Start/End: Original strand, 48096541 - 48096692
Alignment:
| Q |
88 |
tacaagaaacttcaaccaatatcaaaccttctt---gcagtataagcggagtccttac------ggtcaattgtcattatagacagtgatcatgtctata |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48096541 |
tacaagaaacttcaaccaatatcaaaccttcttcttgcagtataagcggagtccttacggttacggtcaattgtcattatagacagtgatcatgtctata |
48096640 |
T |
 |
| Q |
179 |
taaaaagatcaaacaattaagattatcaa-tttttaattggccaaaacttct |
229 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
48096641 |
taaaaagatcaaacaattaagattatgaattttttaattggccaaaacttct |
48096692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 76
Target Start/End: Original strand, 48096483 - 48096513
Alignment:
| Q |
46 |
agagaggatctgtaatgctggtcggttcagc |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48096483 |
agagaggatctgtaatgctggtcggttcagc |
48096513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 47 - 89
Target Start/End: Complemental strand, 39882982 - 39882940
Alignment:
| Q |
47 |
gagaggatctgtaatgctggtcggttcagcaaagatgaggtta |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39882982 |
gagaggatctgtaatgctggtcggttcagcgaagatgaggtta |
39882940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University