View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12040_high_43 (Length: 220)
Name: NF12040_high_43
Description: NF12040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12040_high_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 21 - 208
Target Start/End: Complemental strand, 28153606 - 28153419
Alignment:
| Q |
21 |
cacaaatcagaagaaatctatcactaagtaatcaaaagagataaatcaaggataaagaaacagttttctatgcatcggggaagtattgtgaaatcattca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28153606 |
cacaaatcagaagaaatctatcactaagtaatcaaaagagataaatcaaggataaagaaacagttttctatgaatcggggaagtattgtgaaatcattca |
28153507 |
T |
 |
| Q |
121 |
gtcaattcagatgacgtaagacgactattaggtaacttggacatggggagtttcttaggacaataattagttcgtatgtactgtgatg |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28153506 |
gtcaattcagatgacgtaggacgactattaggtaacttggatatggtgagtttcttaggacaataattagttcgtatgtactgtgatg |
28153419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University