View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12040_low_30 (Length: 315)
Name: NF12040_low_30
Description: NF12040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12040_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 304
Target Start/End: Complemental strand, 35953370 - 35953074
Alignment:
| Q |
21 |
tgatggtaaaagattattttacatcgttggtgtactccat---taaacttcaaatatatttcagattaa----------ttaatacttgtctgcaagtga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35953370 |
tgatggtaaaagattattttacatcgttagtgtactccataattaaacttcaaatatatttcagattaacaaagattaattaatacttgtctgcaagtga |
35953271 |
T |
|
| Q |
108 |
taaagcatgaaaaaccaaaacttgttagcattttccaaaccaaaatgcagaagggtccctatgacccaacagatgtaataaatgcaaacctatggggacc |
207 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35953270 |
taaagcatgaaaaaccaaaacttgttaacattttccaaaccaaaatgcagaagggtccctatgacccaacagatgtaataaatgcaaacctgtggggacc |
35953171 |
T |
|
| Q |
208 |
actgcatattcgaccaatgcttgtttggtgagacttctcatcatgtctatatacgttatgcaatgaatgcatttctatttattgcagctaaattcat |
304 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35953170 |
actgcatattcgaccaatgcttgttttgtgagacttctcatcaagtctatatacgttatgcaatgaatgcatttctatttattgcagctaaattcat |
35953074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University