View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12040_low_35 (Length: 250)
Name: NF12040_low_35
Description: NF12040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12040_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 99 - 237
Target Start/End: Original strand, 38711489 - 38711627
Alignment:
| Q |
99 |
tggctgaagcgagtttcatgcgtcccgacacagtatgtttatttaaatgttataaattgctatgctaactgtgattatattgtttcagcttctgtaatat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38711489 |
tggctgaagcgagtttcatgcgtcccgacacagtatgtttatttaaatgttataaattgctatgctaactgtgattatattgtttcagcttctgtaatat |
38711588 |
T |
|
| Q |
199 |
attgaaattctgaatagtgcttattatatctttattatt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38711589 |
attgaaattctgaatagtgcttattatatctttattatt |
38711627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 15 - 84
Target Start/End: Original strand, 38711301 - 38711370
Alignment:
| Q |
15 |
atacaaaggtcttcaaacaatgaagatgattaagtatagcatgaacattgcattgtggtcagtgttaaaa |
84 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38711301 |
atacaaaggtcttcaaataatgaagatgattaagtatagcatgaacattgcattgtggtcagtgttaaaa |
38711370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 84
Target Start/End: Complemental strand, 38688763 - 38688692
Alignment:
| Q |
16 |
tacaaaggtcttcaaacaatgaagatgattaagtatagcatg---aacattgcattgtggtcagtgttaaaa |
84 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||| ||||||||||| || | |||||||||| |
|
|
| T |
38688763 |
tacaaaggccttcaaacaatgaagatgagtaagtatagcatgaataacattgcattctgattagtgttaaaa |
38688692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University