View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12040_low_42 (Length: 238)
Name: NF12040_low_42
Description: NF12040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12040_low_42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 46 - 220
Target Start/End: Original strand, 31085317 - 31085491
Alignment:
| Q |
46 |
agaactcattaagaaacttgtatgctgattttaccgagaattcacattttttattcaccacccataagaatttatcctgctgttgcgatggaaggatcgg |
145 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31085317 |
agaactcattaagaaacttgtatgccgattttaccgagaattcacattttttattcaccacccataagaatttatcctgctgttgcgatggaaggatcgg |
31085416 |
T |
 |
| Q |
146 |
aatttgcataatttgttgacttcaaaggcaaagaataactcattcagcagctgaattttccatcctccatatttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31085417 |
aatttgcataatttgttgacttcaaatgcaaagaataactcattcagcagctgaattttccatcctccatatttt |
31085491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 54 - 120
Target Start/End: Original strand, 47489661 - 47489727
Alignment:
| Q |
54 |
ttaagaaacttgtatgctgattttaccgagaattcacattttttattcaccacccataagaatttat |
120 |
Q |
| |
|
|||||||||||||| | |||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
47489661 |
ttaagaaacttgtacaccgattttactgagaatacacatttttcattcaccacccataagaatttat |
47489727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University