View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12041_low_12 (Length: 249)
Name: NF12041_low_12
Description: NF12041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12041_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 31658679 - 31658583
Alignment:
| Q |
1 |
catttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658679 |
catttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg |
31658583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 199 - 236
Target Start/End: Complemental strand, 31658558 - 31658521
Alignment:
| Q |
199 |
taatgggagatttatttgatcgtttaacttatgatgtc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658558 |
taatgggagatttatttgatcgtttaacttatgatgtc |
31658521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University