View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12042_high_10 (Length: 337)
Name: NF12042_high_10
Description: NF12042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12042_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 22584113 - 22584434
Alignment:
| Q |
1 |
atgaacttcacttgctttatggtcttgggttggtccttgtgaagaggtagccttggacttcttcattggtggatgagaatgagattgatgtgattgtccc |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
22584113 |
atgaacttcacttgctttatgttcttgggttggtccttgtgaagaggtagccttggacttcttcattggtggatgagattgagattgatgtgattgaccc |
22584212 |
T |
 |
| Q |
101 |
actatgaaataagggtaagcaaagtgcaagtgaagtccttcataagtgattatgagagtgtcagggtcctcattggatctctcaacctgcttcttagctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22584213 |
actatgaaataagggtaagcaaagtgtaagtggagtccttcataagtgattatgagagtgtcagggtcctcattggatctctcaacctgcttcttagctc |
22584312 |
T |
 |
| Q |
201 |
cacaccttgggttggtgcatctatagtaactcctgttttttccatggcataaaaaatttatactgaaaaattaaattttgtattgtgaaattaatcttct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22584313 |
cacaccttgggttggtgcatctatagtaactcctgttttttccatggcataaaaaatttatactgaaaaattaaattttgtattgtgaaattaatcttct |
22584412 |
T |
 |
| Q |
301 |
ccaattagttaagggtaccttt |
322 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
22584413 |
ccaattagttaagggtatcttt |
22584434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University