View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12042_low_14 (Length: 252)
Name: NF12042_low_14
Description: NF12042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12042_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 39688610 - 39688356
Alignment:
| Q |
1 |
tagttattttgaatgggaaatcct---gctaatccataagcaacggagtgatgtcaatgcaagaaacaacatgtggatgtgtcggtgcaagtatatagca |
97 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39688610 |
tagttattttgaatgggaaatccttatgctaatccataagcaacggagtgatgtcaatgtaagaaacaacatgtggatgtgtcggtgcaagtatatagaa |
39688511 |
T |
 |
| Q |
98 |
gatcaaaaagaggccaacta-------acaatgttggtgggttgggttgaattgagtgctcaatttcagtacttttatgtggggtgtgtaatacagttat |
190 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39688510 |
gatcaaaaagaggccaactagcaactaacaatgttggtgggttaggttgaattgagtgctcaatttcagtacttttatgtggggtgtgtaatacagttat |
39688411 |
T |
 |
| Q |
191 |
agtaagtggaagatacacttccgtgatgaacaaaaacatgatttttgtctgtgct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39688410 |
agtaagtggaagatacacttccgtgatgaacaaaaacatgatttttgtctgtgct |
39688356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University