View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12043_low_3 (Length: 407)
Name: NF12043_low_3
Description: NF12043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12043_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 136 - 359
Target Start/End: Complemental strand, 31942450 - 31942228
Alignment:
| Q |
136 |
gtattgcaatttttcggaattttcatctgcataaccttctttgttttttgaagtaccatctacatacataatacatgtttcttaccnnnnnnngaacaat |
235 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31942450 |
gtattgcaatttttcggaatttccatctgcatatccttttttgttttttgaagtaccatctacatacataatacatgtttcttaccaaaaaa-gaacaat |
31942352 |
T |
 |
| Q |
236 |
attaccacgtccttcaaatcatagtcgcatgtactggctaagtttggaccaaacaaatcccgacagttccatattgttctgacacgtatattttatgtga |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31942351 |
attaccacgtccttcaaatcatagtcgcatgtaccggctaagtttggaccaaacaaatcccgacagttccacattgttctgacacgtatattttatgtga |
31942252 |
T |
 |
| Q |
336 |
atcttttaacgaatatatttttgt |
359 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
31942251 |
gtcttttaacgattatatttttgt |
31942228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 31942585 - 31942529
Alignment:
| Q |
1 |
gaatcttctctttttgttgcggagtgatgcagcgcgaaccttctttttgagagattat |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
31942585 |
gaatcttctctttttgttgcggagtgatgcggcgcgaacctt-tttttgagagattat |
31942529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University