View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12044_high_12 (Length: 240)
Name: NF12044_high_12
Description: NF12044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12044_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 154
Target Start/End: Complemental strand, 18770570 - 18770436
Alignment:
| Q |
16 |
atatatatatttttgcttgaccataaaatccaatctcattgggtgctccaatgtcggtgcattaattaacactatatacataatagcatatatataaaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18770570 |
atatatatatttttgcttgaccataaaatccaatctcattgggtgctccaatgtcggtgcattaa----cactatatacataatagcatatatataaaaa |
18770475 |
T |
 |
| Q |
116 |
ttataaaaatcgtacaaacttagacacgttcgtgacaat |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18770474 |
ttataaaaatcgtacaaacttagacacgttcgtgacaat |
18770436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University