View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12044_high_8 (Length: 253)
Name: NF12044_high_8
Description: NF12044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12044_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 83 - 238
Target Start/End: Complemental strand, 45465601 - 45465446
Alignment:
| Q |
83 |
aagatagattgttaattgaatgaatgattgattcggtgattgaagcggtgaggaagaagaggagtatttgttaatggagaagatgagtccagatgtttct |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45465601 |
aagatagattgttaattgaatgaatgattgattcggtgattgaagcggtgaggaagaagaggagtatttgttaatggagaagatgagtccagatgtttct |
45465502 |
T |
|
| Q |
183 |
ggggggaagagaaaaagaaactactagaatactctcttatattcgagtcttttctt |
238 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
45465501 |
gtggggaagagaaaaagaaactactagaattctctcttctattcgagtcttttctt |
45465446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University